H-0117HerbariumPolypodiaceae

Widow's Fern

Polypodium memorans

Under cultivation

An ordinary fern whose fronds uncurl only near the recently bereaved — and whose genome remembers who was lost.

Collected at: Abandoned greenhouse, Brno outskirts
Date: 1987
Collector: Dr. L. Havel
Anomalies: Human DNAEmotional response

Sequenced fragment

ATGGCTAAGTTCCGATCGGATTACGGATCACAGGTCTATCACCCTATTAGCCGTAAGCTTGCAAGTCCG

69 bpGC 49%20 anomalous0.3% of the genome encodes human mtDNA, haplogroup H1. Match confirmed against the collector's late wife.

Description

A small polypody fern with a creeping rhizome about 8 cm long, densely covered in rust-brown scales and trailing fine dark roots. Its fronds, up to 25 cm long when open, are narrow and deeply cut into blunt, alternate segments with round orange-brown sori beneath. Botanically it is indistinguishable from Polypodium vulgare.

Observations

The fronds remain tightly coiled in croziers for the life of the plant, uncurling only in the presence of a person who has lost someone close within the past year. Uncurling takes between four and eleven minutes and is fully reversible.

Genetic analysis

Routine barcoding returned a clean Polypodium profile with one exception — a 412 bp insertion in the chloroplast genome that is unmistakably human mitochondrial DNA. The sequence matched, to the base, a sample on file for Marta Havlová (d. 1986), the collector’s wife.

Every propagated specimen carries an equivalent insertion. None of them match Marta. Each matches someone who died near the place the new plant was grown.

Cultivation

Propagates readily from spores in standard fern compost. Prefers shade, humidity, and quiet. Three specimens are currently under cultivation in the north bay of the Glasshouse, where staff are asked not to linger.

Effects

None measurable on the observer. Several visitors have described the uncurling as “being recognised”. Two have asked to take a spore print home. Requests are declined.

Filed alongside

GlasshouseUnder cultivation

Mending Ivy

Hedera reparans

A climbing ivy that slowly repairs whatever it grows over — cracked pots, torn paper, once a broken wrist.

HerbariumArchived

Lamplighter's Moss

Bryum vesperale

A cushion moss that photosynthesises from attention rather than light, and dies in rooms nobody visits.

GlasshouseDormant

Funeral Laughter

Calendula hilarans

A marigold that sprouts only at funerals and makes the mourners remember something funny about the dead.