- No.
- G-0042
- Fam.
- Araliaceae
- Loc.
- Churchyard wall, Kutná Hora
- Leg.
- Sister A. Novotná, spring 1954
G-0042GlasshouseAraliaceae
Mending Ivy
Hedera reparans
Under cultivationA climbing ivy that slowly repairs whatever it grows over — cracked pots, torn paper, once a broken wrist.
- Collected at
- Churchyard wall, Kutná Hora
- Date
- spring 1954
- Collector
- Sister A. Novotná
- Anomalies
- RestorativeUnstable genome
Sequenced fragment
GGCATTACGCTAGGCTTACCGGATXXACGTTAGCAACGTACGTACGTACGTTAGGCATCCGGATAG
Description
A slow-growing, small-leaved ivy with wiry, reddish-brown stems and three- to five-lobed leaves 1.5–3 cm across, dark green with paler veins. The stems are set along one side with dense tufts of unusually fine, pale aerial rootlets.
Observations
Where the rootlets contact a damaged surface they deposit a thin, glassy secretion that cures over weeks into a material matching the substrate — ceramic on ceramic, paper on paper, stone on stone.
Genetic analysis
The genome is unstable in a way that appears deliberate. A 30 bp motif in the third chromosome is rewritten between consecutive sequencing runs, as though the plant were checking its own work.
Cultivation
Grows anywhere, but only climbs things that are broken. Placed against an intact wall it lies flat on the floor and sulks.
Effects
The 1954 collection record notes that Sister Novotná’s fractured wrist “set clean within the fortnight” after she slept beside the cuttings. The Institute does not recommend repeating this.
Filed alongside
Widow's Fern
Polypodium memorans
An ordinary fern whose fronds uncurl only near the recently bereaved — and whose genome remembers who was lost.
Company Mistletoe
Peraxilla tetrapetala
From 1967 to 1994 a Te Anau florist could see herself only with someone else in the mirror, so her neighbour came round every morning at 7.40.
Quorum Thistle
Cirsium consensus
A thistle colony that voted, measurably, on where to spread next, and was destroyed after its third vote.