- No.
- G-0007
- Fam.
- Asteraceae
- Loc.
- Vyšehrad cemetery
- Leg.
- Unknown gardener, 1923
G-0007GlasshouseAsteraceae
Funeral Laughter
Calendula hilarans
DormantA marigold that sprouts only at funerals and makes the mourners remember something funny about the dead.
- Collected at
- Vyšehrad cemetery
- Date
- 1923
- Collector
- Unknown gardener
- Anomalies
- Emotional responseTemporal
Sequenced fragment
ACGTTAGCATGCCGTAGCTAGCTAGGATTACAGATTACAGCTAGCATCGATCGTAGC
Description
A small marigold about 12 cm tall with a single flower head 5 cm across: layered, bright orange florets around a darker brown disc. The slender stem carries three or four narrow, oblong leaves, and the seeds are curved, ridged and pale brown.
Observations
Seeds remain viable indefinitely and germinate within minutes when carried into a funeral, regardless of soil, season or container — coat pockets have been recorded.
Genetic analysis
The genome contains a 22 bp palindromic sequence that reads identically on both strands. Its function is unknown. Its presence correlates perfectly with germination events.
Cultivation
The Institute holds forty seeds in a dry tin. It does not attempt to grow them.
Effects
Mourners within sight of an open flower recall, unprompted and vividly, a funny memory of the deceased. Laughter follows. No case of offence has ever been recorded.
Filed alongside
Widow's Fern
Polypodium memorans
An ordinary fern whose fronds uncurl only near the recently bereaved — and whose genome remembers who was lost.
Sleeper's Clover
Trifolium somniferum
A clover that closes its leaves at the exact moment anyone in the building falls asleep, and opens them for dreams that go well.
Grace Lily
Nymphaea moratoria
A Lapland water lily that, for the nine weeks it is in flower, stops every legal deadline in sight of its pond: tax, leases and evictions.