Sleeper's Clover

Trifolium somniferum

Under cultivation

A clover that closes its leaves at the exact moment anyone in the building falls asleep, and opens them for dreams that go well.

Collected at: Children's ward, Olomouc
Date: 1999
Collector: Nurse P. Horák
Anomalies: Extinct genesEmotional response

Sequenced fragment

GCTAGCATCGATTAGCCGATGCATTAGCGGGATTACCGATCGTAGCATGCATCGA

55 bpGC 51%16 anomalousCarries a gene otherwise found only in a Miocene legume known from fossil pollen.

Description

A low, creeping clover about 18 cm across, its runners rooting at the nodes. Each leaf has three rounded, pale green leaflets 1–1.5 cm wide marked with a faint pale chevron, and globular heads of white florets stand on stalks 5–7 cm tall.

Observations

The leaves fold shut each time a person within the same building falls asleep, and reopen when a dream turns pleasant.

Genetic analysis

Contains a functional copy of a gene known only from fossilised pollen of a Miocene legume, extinct for roughly ten million years.

Cultivation

Easy. Prefers windowsills in places where people sleep badly.

Effects

Hospital staff report the clover is a reliable indicator of how the night is going. Patients sleeping near it report dreams of open fields.

Filed alongside

GlasshouseDormant

Funeral Laughter

Calendula hilarans

A marigold that sprouts only at funerals and makes the mourners remember something funny about the dead.

GlasshouseUnder cultivation

Height-Mark Sorghum

Sorghum bicolor

A Javanese sorghum whose stalks stop at the exact height of any child who stands beside them, and once stopped for the night watchman.

HerbariumUnder cultivation

Widow's Fern

Polypodium memorans

An ordinary fern whose fronds uncurl only near the recently bereaved — and whose genome remembers who was lost.