Pilot Light

Lumenaria vigil

Under cultivation

A small flowering plant that glows whenever someone is lost in the building, and dims as they find their way out.

Collected at: Boiler room, the Institute
Date: winter 1947
Collector: Caretaker O. Kříž
Anomalies: Emotional responseRestorative

Sequenced fragment

GCTAGCATCGTAGCATGCTAGCATCGATCGTAGCATCGATCGGCATGCATCG

52 bpGC 54%18 anomalousBioluminescence genes from a deep-sea dinoflagellate, inserted with no trace of a vector.

Description

A low rosette plant about 12 cm across, with seven round, slightly cupped leaves 2–3 cm wide on short stalks, dull olive-green with paler veins. A single slender stem about 8 cm tall carries one five-petalled flower 3 cm across, its thin petals pale cream deepening to honey-amber at the throat.

Observations

The bloom emits a steady amber light. Brightness rises when anyone in the building cannot find their way, and falls as they approach an exit.

Genetic analysis

Contains a complete bioluminescence cassette otherwise known only from a deep-sea dinoflagellate. There is no trace of the means by which it got there.

Cultivation

Kept on the basement landing, at the foot of the stairs, where it was found.

Effects

Visitors who reach the basement report the bloom is “already on” when they arrive.