Index Moss

Sphagnum catalogi

Dormant

A moss that grew over the old card catalog and now writes new cards — for specimens the Institute has not collected yet.

Collected at: Basement card cabinet, drawer 14
Date: 1968
Collector: Archivist E. Brabcová
Anomalies: Encoded messageTemporal

Sequenced fragment

CATTAGCGATCGATCGATCGATCGATCGTAGCATTAGCCGATCGATCGATAGCA

54 bpGC 48%20 anomalousThe repeating motif matches the cabinet's drawer numbering when read as base four.

Description

A low, rust-green bog moss forming a dense mat about 12 × 8 cm, its stems 1–2 cm tall and closely packed, with small overlapping leaves and clustered branch heads. It grows over the inside of drawer 14 of the oak card catalog in the basement archive.

Observations

Where the moss grows over blank index cards, the cards slowly darken into legible typescript: catalog number, common name, taxon, place of collection.

Genetic analysis

The genome carries a repeating motif that, read as base four, reproduces the drawer numbering of the cabinet it grows in. Transplanted samples die within a day.

Cultivation

None. The cabinet is locked and the key is kept upstairs, in a drawer the moss cannot reach.

Effects

Forty-one cards have been written since 1968. Nine describe specimens that have since been found. The rest are unaccounted for.

Filed alongside

HerbariumDestroyed

Quorum Thistle

Cirsium consensus

A thistle colony that voted, measurably, on where to spread next, and was destroyed after its third vote.